Product Class: Other

mRNA Cap N6 Methyltransferase (m6A)
Gray property icon for NEBU recombinant Gray property icon for incubation temperature 37° Gray property icon for SAM

Product Introduction

mRNA Cap N6 Methyltransferase (m6A) is a cap-specific adenosine methyltransferase that methylates the N6 position of an initiating adenine of 5´ capped RNA transcripts.

  • Enables enzymatic modification of capped mRNAs
  • Simplify workflows with a low-cost, one-pot reaction to generate Cap-1 m6A RNAs with FCE and mRNA Cap 2´-O-Methyltransferase
  • Improve translation and transcript stability using Cap-1 m6A - a naturally occurring modification and an alternative to synthetic 3′-O-methyl cap analogs.
Bioz Badge Exists : True
Catalog # Size Concentration
M0767S 1000 units 25000 units/ml

Product Information

Description

mRNA Cap N6 Methyltransferase (m6A) adds a methyl group at the N6 position of the initiating adenine of 5´ capped RNA transcripts. This enzyme utilizes S-adenosylmethionine (SAM) as a methyl donor to methylate the initiating adenine of capped RNAs, resulting in N6-methyladenosine (m6A). It is critical that the RNA is capped (i.e., Cap-0 or Cap-1 RNA), and the first nucleotide adjacent to the cap at the 5´ end of the RNA is adenine in order to be methylated. When this N6 methylation occurs on a Cap-1 transcript, which already contains a 2´-O-methyl group, the resulting modification is N6,2′-O-dimethyladenosine (m6Am or Cap-1 m6A), a naturally occurring, cap-proximal modification commonly found in eukaryotic mRNAs and enriched in certain vertebrate tissues. Growing evidence suggests that N6,2′-O-dimethyladenosine influences translation efficiency, such as by reducing mRNA decapping and increasing mRNA stability.

If using T7 RNA polymerase to synthesize uncapped RNA that initiates with adenine, we recommend the T7 Promoter class II with the first three transcribed nucleotides being AGA: 5'- TAATACGACTCACTATTAGA 3'. T7 RNA polymerase starts transcription at the underlined A (+1 position) in the sequence.

 

Figure 1: Schematic representation of Cap-1 m6A RNA showing the 7-methylguanosine cap (m7G), the 5´ to 5´ triphosphate linkage (ppp), and the initiating N6, 2´-O-dimethyladenosine (m6Am)

Diagram of Cap-1 m6A methylations

 

Figure 2: 50U of mRNA Cap N6 Methyltransferase (m6A) can fully methylate up to 180 µg of capped RNA after 1 h at 37°C in 1X Capping Buffer, if the RNA transcript initiates with adenine (+1 A). This methyltransferase will not methylate uncapped RNAs. More enzyme and/or longer reaction times may be needed for RNAs that are shorter than 1000 nt

Bar graph depicting percent N6-methylated mRNA for various capped substrates, with our without m6A

Product Source

An E. coli strain carrying a gene encoding mRNA Cap N6 Methyltransferase (m6A) with a C-terminal 6xHis-tag.
This product is related to the following categories:
RNA Capping,

Reagents Supplied

Reagents Supplied

The following reagents are supplied with this product:

NEB # Component Name Component # Stored at (°C) Amount Concentration

Properties & Usage

Reaction Conditions

1X Capping Buffer
Supplement with S-adenosylmethionine (SAM)
Incubate at 37°C

1X Capping Buffer
50 mM Tris-HCl
5 mM KCl
1 mM MgCl2
1 mM DTT
(pH 8 @ 25°C)

References

  1. Mauer J, et al. (2017). Reversible methylation of m6Am in the 5' cap controls mRNA stability. Nature. Jan 19;541(7637), 371-375. PubMedID: 28002401
  2. Akichika S, et al. (2019). Cap-specific terminal N6-methylation of RNA by an RNA polymerase II-associated methyltransferase. Science. Jan 11;363(6423), eaav0080. PubMedID: 30467178
  3. Sendinc E, et al. (2019). PCIF1 Catalyzes m6Am mRNA Methylation to Regulate Gene Expression. Mol Cell. Aug 8;75(3), 620-630.e9. PubMedID: 31279659
  4. Boulias K, et al. (2019). Identification of the m6Am Methyltransferase PCIF1 Reveals the Location and Functions of m6Am in the Transcriptome. Mol Cell. Aug 8;75(3),  631-643. PubMedID: 31279658
  5. Sikorski PJ, et al. (2020). The identity and methylation status of the first transcribed nucleotide in eukaryotic mRNA 5′ cap modulates protein expression in living cells. Nucleic Acids Res. Feb 28;48(4), 1607-1626. PubMedID: 31984425
  6. Mandell ZF, et al. (2025). CleanCap M6 inhibits decapping of exogenously delivered IVT mRNA. Mol Ther Nucleic Acids. Jan 17;36(1), 102456. PubMedID: 39974289
  7. Liu JF, et al. (2025). Decoding m6Am by simultaneous transcription-start mapping and methylation quantification. Elife. Mar 31:13, RP104139. PubMedID: 40162895

FAQs & Troubleshooting

FAQs

  1. What is Cap-0 and Cap-1?
  2. What kind of RNA can be methylated using mRNA Cap N6 Methyltransferase (m6A) (NEB #M0767)?
  3. What is the difference between “N6” and “m6A” nomenclature?
  4. Do I need to change my IVT template to be able to synthesize m6A Cap-0 or m6A Cap-1 RNA?
  5. Can RNase inhibitor be added to mRNA Cap N6 Methyltransferase (m6A) (NEB #M0767) reactions?
  6. Will mRNA Cap N6 Methyltransferase (m6A) (NEB #M0767) methylate other adenines beyond +1 A?
  7. Is mRNA Cap N6 Methyltransferase (m6A) (NEB #M0767) active at temperatures other than 37°C?

Quality, Safety & Legal

Quality Assurance Statement

Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.

Specifications

The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]

Certificate Of Analysis

The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

Safety DataSheets

The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.

Legal and Disclaimers

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.

Other Products You May Be Interested In