We are excited to announce that all reaction buffers are now BSA-free. NEB began switching our BSA-containing reaction buffers in April 2021 to buffers containing Recombinant Albumin (rAlbumin) for restriction enzymes and some DNA modifying enzymes. Find more details at www.neb.com/BSA-free.
Product Introduction
- 100% activity in rCutSmart™ Buffer (over 210 enzymes are available in the same buffer) allowing for easier double digests
- This is a homing endonuclease and requires 3 hour incubation periods
- Tolerates some sequence degeneracy within recognition sequence
- Restriction Enzyme Cut Site: TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
Bioz Badge Exists
:
True
Catalog # |
Size |
Concentration |
R0699S |
500.0 units |
5000 units/ml |
R0699L |
2500.0 units |
5000 units/ml |
-
Reduce Star Activity with High-Fidelity Restriction Enzymes
-
Standard Protocol for Restriction Enzyme Digests
-
NEB® TV Ep. 15 – Applications of Restriction Enzymes
-
Restriction Enzyme Digest Protocol: Cutting Close to DNA End
-
Restriction Enzyme Digestion Problem: DNA Smear on Agarose Gel
-
Why is My Restriction Enzyme Not Cutting DNA?
-
Restriction Enzyme Digest Problem: Too Many DNA Bands
-
Double Digestion with NEBcloner