Product Class: Other

pUC19 Vector

Product Introduction

  • View sequence details
  • pUC19 is a commonly used cloning vector that conveys the Amp resistance.
  • The molecule is a small double-stranded circle, 2686 base pairs in length, and has a high copy number.
  • pUC19 carries a 54 base-pair multiple cloning site polylinker that contains unique sites for 13 different hexanucleotide-specific restriction endonucleases (1).
  • NEB offers a selection of common cloning plasmids and DNAs for use as substrates.
 
Bioz Badge Exists : True
Catalog # Size Concentration
N3041S 50.0 µg 1000 µg/ml
N3041L 250.0 µg 1000 µg/ml

Product Information

Description



DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.

Product Source

pUC19 is isolated from E. coli ER2272 (dam+ dcm+ EcoK M-) by a standard plasmid purification procedure.

Polylinker DNA Sequence

GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT 

GENBANK Assession Number

L09137
This product is related to the following categories:

Reagents Supplied

Reagents Supplied

The following reagents are supplied with this product:

NEB # Component Name Component # Stored at (°C) Amount Concentration

Properties & Usage

General Utility

Cloning

Copy Number

High (100+)

Origin of Replication

  • pMB1 (high-copy mutant)

Lac Repressor on Plasmid

0

Storage Buffer

10 mM Tris-HCl
1 mM EDTA
pH 8 @ 25°C

References

  1. Yanisch-Perron, C., Vieira, J. and Messing, J. (1985). Gene. 33, 103-119.

Tools & Resources

Web Tools

FAQs & Troubleshooting

FAQs

  1. How homogeneous is the DNA/ how much is supercoiled?
  2. Are the plasmids cesium purified?
  3. What is the DNA sequence of this product?

Quality, Safety & Legal

Quality Assurance Statement

Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.

Specifications

The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]

Certificate Of Analysis

The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

Safety DataSheets

The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.

Legal and Disclaimers

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.

Other Products You May Be Interested In