Product Class: Other

Nucleosome Control DNA

  • Catalog # N1202 was discontinued on December 18, 2023

Product Introduction

Lytechinus variegatus 5SrDNA (1), 208 bp is used for mononucleosome formation in a gel shift assay.

  • Purified free of contaminating proteins and RNA
  • Positive control for EpiMark Nucleosome Assembly Kit
Bioz Badge Exists : True
Catalog # Size Concentration

Product Information

Description

 

Source

Plasmid (Litmus 29) containing five copies 5SrDNA isolated from E. coli NEB 10-beta by a standard purification procedure, digested and then the 208 bp fragment is purified.

Sequence

ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAAT
AGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACC
GGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTG
GATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA
This product is related to the following categories:

Reagents Supplied

Reagents Supplied

The following reagents are supplied with this product:

NEB # Component Name Component # Stored at (°C) Amount Concentration

Properties & Usage

Storage Buffer

10 mM Tris-HCl
1 mM EDTA
pH 8 @ 25°C

Application Features

  • A positive control for EpiMark Nucleosome Assembly Kit.

Product Notes

  1. A260/A280: > 1.80

References

  1. Lu, A-Lien et al. (1980). Nucleic Acids Res.. 8, 1839-1853.

Quality, Safety & Legal

Quality Assurance Statement

Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.

Specifications

The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]

Certificate Of Analysis

The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

Safety DataSheets

The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.

Legal and Disclaimers

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.