Product Class: Kit

EpiMark® 5-hmC and 5-mC Analysis Kit

  • Catalog # E3317 was discontinued on December 18, 2023

Product Introduction

The EpiMark® 5-hmC and 5-mC Analysis Kit can be used to analyze and quantitate 5-methylcytosine and 5-hydroxymethylcytosine within a specific locus. Complete conversion of 5-hmC to glucosylated 5-hmC in DNA by T4 β-glucosyltransferase (T4-BGT).

  • Discrimination between 5-mC and 5-hmC in CCGG sequences using enzymatic digestion and PCR amplification
  • Relative quantitation of 5-mC and 5-hmC
  • Easy-to-use protocol
  • This kit contains enough material for 20 reactions
Bioz Badge Exists : True
Catalog # Size Concentration

Product Information

Description

5-methylcytosine (5-mC) is the predominant epigenetic mark in mammalian genomic DNA. 5-hydroxymethylcytosine (5-hmC) is a newly discovered epigenetic modification that is presumably generated by oxidation of 5-mC by the TET family of cytosine oxygenases.1,2

Techniques exist that can identify 5-mC in genomic DNA, but the most commonly used method, bisulfite sequencing, is laborious and cannot distinguish between 5-mC from 5-hmC.3 

The kit distinguishes 5-mC from 5-hmC by the addition of glucose to the hydroxyl group of 5-hmC via an enzymatic reaction utilizing T4 β-glucosyltransferase (T4-BGT). When 5-hmC occurs in the context of CCGG, this modification converts a cleavable MspI site to a noncleavable one.

An overview of the detection procedure is summarized in Figure 1.

Control DNA Sequence 
5´-CAGTGAAGTTGGCAGACTGAGCCAGGTCCCACAGATGCAGTGACCGGAGT
CATTGCCAAACTCTGCAGGAGAGCAAGGGCTGTCTATAGGTGGCAAGTCA-3´

Control DNA substrates are synthetic 100 bp double stranded fragments containing a single MspI/HpaII site (CCGG). The three fragments are identical except for modification of the internal C in this site.

FW Primer Sequence 
5´- CA GTG AAG TTG GCA GAC TGA GC -3´

REV Primer Sequence 
5´- CTG ACT TGC CAC CTA TAG ACA GC -3´
This product is related to the following categories:
Discontinued (<3 years),

Kit Components

Kit Components

The following reagents are supplied with this product:

NEB # Component Name Component # Stored at (°C) Amount Concentration
  • NEB # Stored at (°C)
    E3317S -20

Properties & Usage

Materials Required but not Supplied

Heat block or water bath (suitable for temperatures of 37°C, 40°C and 95°C) PCR materials:
  • Locus-specific primers, flanking a CCGG site of interest
  • DNA polymerase for PCR
  • Nucleotides for PCR
  • PCR Thermal Cycler (for endpoint experiments, option IIIa)
  • Real-time PCR cycler (for quantitative experiments, option IIIb)
0.2 ml strip tubes and caps for PCR
1.5 ml reaction tubes
Molecular biology grade water

Method Overview

Step I: DNA Glucosylation Reaction with T4 β-glucosyltransferase (T4-BGT) Genomic DNA of interest is treated with T4-BGT, adding a glucose moeity to 5-hydroxymethylcytosine. This reaction is sequence-independent - therefore all 5-hmC will be glucosylated, unmodified or 5-mC containing DNA will not be affected.

Step II: Restriction Endonuclease DigestionMspI and HpaII recognize the same sequence (CCGG) but are sensitive to different methylation status. HpaII cleaves only a completely unmodified site: any modification (5-mC, 5-hmC or 5-ghmC) at either cytosine blocks cleavage. MspI will recognize and cleave 5-mC and 5-hmC, but not 5-ghmC.

Step III: Interrogation of the Locus by PCR as little as 20 ng of input DNA can be used. Amplification of the experimental (glucosylated and digested) and control (mock glucosylated and digested) target DNA with primers flanking a CCGG site of interest (100–200 bp) is performed. If the CpG site contains 5-hydroxymethylcytosine, a band is detected after glucosylation and digestion, but not in the non-glucosylated control reaction (see Figure 2). Real time PCR will give an approximation of how much hydroxymethylcytosine is in this particular site.

Figure 1a: Experimental Overview Figure 1a: Experimental Overview

The DNA of interest is treated with T4 β-Glucosyltransferase (T4-BGT) and UDP-Glucose (UDP-Glc). T4-BGT transfers glucose from UDP-Glc onto 5-hydroxymethylcytosine (generating glucosylated 5-hydroxymethylcytosine [5-ghmC]). MspI cuts DNA containing 5-hmC, but does not cut 5-ghmC containing sites; in contrast, HpaII is blocked by any of these modifications. Presence of 5-hmC and 5-mC can be determined by PCR analysis.
Figure 1b: Experimental OverviewFigure 1b: Experimental overview

The DNA of interest is digested following a control reaction with UDP-Glucose (UDP-Glc) and no T4 β-Glucosyltransferase (T4-BGT), leaving 5-hmC unmodified. MspI cleaves unmodified, 5-mC and 5-hmC DNA, while HpaII cleaves only unmodified DNA.
Figure 2: Comparison of 5-hydroxymethylcytosine amounts at locus 12 in different mouse Balb/C tissue samples. (A) End-point PCR. (B) Real time PCR.Figure 2: Comparison of 5-hydroxymethylcytosine amounts at locus 12 in different mouse Balb/C tissue samples. (A) End-points PCR. (B) Real time PCR

DNA from four mouse tissues was analyzed. For comparative purposes, real time PCR data were normalized to uncut DNA. A standard curve was used to determine copy number. The samples could be normalized by dividing the copy number of samples No 1-6 by the copy number of the control that is undigested (No 5). Boxed gel lane shows variation in 5-hmC present.
Figure 3: High sensitivity 5-hydroxymethylcytosine detection achieved by the EpiMark kit.Figure 3: high sensitivity 5-hydroxymethylcytosine detection achieved by the EpiMark kit.

100 bp unmodified, 5-mC, and 5-hmC control DNAs were mixed in different ratios (blue bars), and then measured with the EpiMark hydroxymethylated DNA detection kit (orange bars). Error bars represent the standard deviation of four independent experiments.

References

  1. Tahiliani, M., Koh, K.P., Shen, Y., Pastor, W.A., Bandukwala, H., Brudno, Y., Agarwal, (2009). Science 324. 930-935, PubMedID: 19372391
  2. Huang, Y, Pastor, W.A., Shen, Y., Tahiliani, M., Liu, D.R., Rao, A. (2010). PloS One. PubMedID: 20126651
  3. Kriaucionis, S. and Heintz, N. (2009). Science 324. 929-930, Epub 2009 Apr 16.

FAQs & Troubleshooting

FAQs

  1. Does the T4-BGT show any site preference?
  2. How do I know if the glucosylation of 5-hmC in my DNA is complete?
  3. How much control DNA should I use in my qPCR?
  4. Do I need to do extra purification steps for a mammalian DNA prep in order to use it in a glucosylation reaction?

Quality, Safety & Legal

Quality Assurance Statement

Quality Control tests are performed on each new lot of NEB product to meet the specifications designated for it. Specifications and individual lot data from the tests that are performed for this particular product can be found and downloaded on the Product Specification Sheet, Certificate of Analysis, data card or product manual. Further information regarding NEB product quality can be found here.

Specifications

The Specification sheet is a document that includes the storage temperature, shelf life and the specifications designated for the product. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]

Certificate Of Analysis

The Certificate of Analysis (COA) is a signed document that includes the storage temperature, expiration date and quality controls for an individual lot. The following file naming structure is used to name these document files: [Product Number]_[Size]_[Version]_[Lot Number]

Safety DataSheets

The following is a list of Safety Data Sheet (SDS) that apply to this product to help you use it safely.

Legal and Disclaimers

Products and content are covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). The use of trademark symbols does not necessarily indicate that the name is trademarked in the country where it is being read; it indicates where the content was originally developed. The use of this product may require the buyer to obtain additional third-party intellectual property rights for certain applications. For more information, please email busdev@neb.com.

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals.

New England Biolabs (NEB) is committed to practicing ethical science – we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Learn more.

Licenses

The purchase of this product conveys to the user the non-transferable right to use the purchased amount of product for Research Use Only. Commercial use of this product may require a license from New England Biolabs. Please contact busdev@neb.com for further details.